sunA [2019-07-03 11:12:16]

sublancin 168 is post-translationally modified antimicrobial precursor peptide from the glycocin class

Locus: BSU21480

Isoelectric point: 7.96

Molecular weight: 5.85 kDa

Protein length: 56 aa

Gene length: 171 bp

Function: exported antimicrobial peptide

Product: sublancin 168 antimicrobial precursor peptide

Essential: no

Synonyms: yolG

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Additional metabolic pathways → Miscellaneous metabolic pathways → Biosynthesis of antibacterial compounds
• Lifestyles → Coping with stress → Biosynthesis of antibacterial compounds
• Lifestyles → Coping with stress → Toxins, antitoxins and immunity against toxins
• Lifestyles → Coping with stress → Toxins, antitoxins and immunity against toxins → Toxins, antitoxins and immunity/ Additional genes
• Prophages and mobile genetic elements → Prophages → SP-beta prophage
• Groups of genes → Secreted proteins

Gene

Coordinates: 2,269,521 2,269,691

The protein

Protein family

• IPP isomerase type 2 family (according to Swiss-Prot)

Modification

• contains a glucose attached to a cysteine residue, glycosylation is essential for its antimicrobial activity PubMed

Structure

• 2MIJ PubMed

Localization

• secreted PubMed

Expression and Regulation

Operons

• Genes: sunA-sunT-bdbA-yolJ-bdbB
  Description: PubMed

  Regulatory mechanism

  • Rok: repression, PubMed, in Rok regulon
  • Abh: activation, PubMed, in Abh regulon
  • DnaA: repression, Rok-DnaA PubMed, in DnaA regulon
  • YvrHb: activation, PubMed, in YvrHb regulon
  • AbrB: repression, PubMed, in AbrB regulon

  Regulation

  • repressed by Rok-DnaA PubMed
  • expression starts in the stationary phase PubMed
  • expression is heterogeneous in the population, this is mediated by AbrB, Rok, and Spo0A PubMed

  Additional information

  • the mRNA is very stable (> 15 min) PubMed
  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

• Genes: sunA
  Description: PubMed

  Regulation

  • repressed by Rok-DnaA PubMed

  Additional information

  • the mRNA is very stable (half-life > 15 min) PubMed

Biological materials

Mutant

• GP1563 (aphA3), available in Jörg Stülke's labb
• GP1565 (sunA-sunI, aphA3), available in Jörg Stülke's lab
• BKE21480 (sunA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA
• BKK21480 (sunA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGTAAAACCTCCCCAT, downstream forward: _UP4_TAAAACATTTGTAGAGGGAA

References

Loading